Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-222 URS00002C6949_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-222: Cfa-mir-222 is a microRNA associated with breast cancer in canines, identified through differential expression analysis in breast cancer mammary tissue (BCMT) compared to normal mammary tissue (BCMT-N) [PMC9917093]. It is also one of the microRNAs that showed significant upregulation in malignant canine mammary tumor tissues (MCMT-T) versus normal tissues (MCMT-N), marking the first recorded instance of such an observation [PMC9917093]. Despite its relevance, research on cfa-mir-222, particularly in canine models, is limited compared to studies on its human counterpart [PMC9917093]. To corroborate findings from high-throughput sequencing, cfa-mir-222 was included in a subset of microRNAs for validation via quantitative PCR (qPCR), although it did not show significant upregulation in the comparison between two canine fibroblast cell lines CFDP1 and CFDP2 [PMC4768678].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUCUGGCUACUGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus (domestic cattle) bta-miR-222
  2. Equus caballus eca-miR-222
  3. Homo sapiens hsa-miR-222-3p
  4. Macaca mulatta (Rhesus monkey) mml-miR-222-3p
  5. Mus musculus mmu-miR-222-3p
  6. Ornithorhynchus anatinus oan-miR-222a-3p
  7. Pongo pygmaeus (Bornean orangutan) ppy-miR-222
  8. Rattus norvegicus (Norway rat) rno-miR-222-3p
  9. Sarcophilus harrisii (Tasmanian devil) sha-miR-222
  10. Tupaia belangeri chinensis (Chinese tree shrew) tch-miR-222-3p
  11. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3161177
Relationships

Molecular Relationships

Publications