Sarcophilus harrisii (Tasmanian devil) sha-miR-222 URS00002C6949_9305

• 21 nucleotides
• 2 databases (MIRBASE, RefSeq)
• Found in 11 other species
• 254 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

mRNA interactions total

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AGCUACAUCUGGCUACUGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

1. Bos taurus (domestic cattle) bta-miR-222
2. Canis lupus familiaris cfa-miR-222
3. Equus caballus eca-miR-222
4. Homo sapiens hsa-miR-222-3p
5. Macaca mulatta (Rhesus monkey) mml-miR-222-3p
6. Mus musculus mmu-miR-222-3p
7. Ornithorhynchus anatinus oan-miR-222a-3p
8. Pongo pygmaeus (Bornean orangutan) ppy-miR-222
9. Rattus norvegicus (Norway rat) rno-miR-222-3p
10. Tupaia belangeri chinensis (Chinese tree shrew) tch-miR-222-3p
11. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3161177

Relationships

Molecular Relationships

Publications Download

• FASTA
• JSON