Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-222-3p URS00002C6949_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-222: rno-mir-222 is a microRNA (miRNA) that has been found to be highly abundant in dihydrotestosterone (DHT)-treated rat ovaries, indicating a potential role in ovarian function or disorders [PMC3682887]. This miRNA, along with others such as rno-miR-221 and rno-miR-25, has been identified as differentially expressed in the theca of cystic follicles exclusively, suggesting a specific localization and function within ovarian tissue [PMC3682887]. Furthermore, rno-mir-222 has been associated with pathological conditions such as cardiac hypertrophy, as it is among several miRNAs identified in microRNA profiling studies related to this cardiac condition [PMC5856749]. Predictive studies have suggested that rno-mir-222 may target genes such as Acadm, indicating its involvement in metabolic pathways within the rat model [PMC6377737]. The generation of miR-222–/– rats through CRISPR technology has facilitated the study of this miRNA's function by allowing researchers to observe the effects of its absence on gene expression and phenotype [PMC8626841]. Lastly, differential expression of rno-miR-222 has been reported in rats with polycystic ovary syndrome (PCOS) compared to controls, highlighting its potential role in this endocrine disorder [PMC4838149].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUCUGGCUACUGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus (domestic cattle) bta-miR-222
  2. Canis lupus familiaris cfa-miR-222
  3. Equus caballus eca-miR-222
  4. Homo sapiens hsa-miR-222-3p
  5. Macaca mulatta (Rhesus monkey) mml-miR-222-3p
  6. Mus musculus mmu-miR-222-3p
  7. Ornithorhynchus anatinus oan-miR-222a-3p
  8. Pongo pygmaeus (Bornean orangutan) ppy-miR-222
  9. Sarcophilus harrisii (Tasmanian devil) sha-miR-222
  10. Tupaia belangeri chinensis (Chinese tree shrew) tch-miR-222-3p
  11. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3161177
Relationships

Molecular Relationships

Publications