Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tupaia chinensis (Chinese tree shrew) tch-miR-222-3p URS00002C6949_246437

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUCUGGCUACUGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus (domestic cattle) bta-miR-222
  2. Canis lupus familiaris cfa-miR-222
  3. Equus caballus eca-miR-222
  4. Homo sapiens hsa-miR-222-3p
  5. Macaca mulatta (Rhesus monkey) mml-miR-222-3p
  6. Mus musculus mmu-miR-222-3p
  7. Ornithorhynchus anatinus oan-miR-222a-3p
  8. Pongo pygmaeus (Bornean orangutan) ppy-miR-222
  9. Rattus norvegicus (Norway rat) rno-miR-222-3p
  10. Sarcophilus harrisii (Tasmanian devil) sha-miR-222
  11. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3161177
Relationships

Molecular Relationships

Publications