Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-30d precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-30d precursor URS000036BDAF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR30D: MIR30D is a microRNA that has been studied in various contexts [PMC5372318]. In a study of cutaneous squamous cell carcinoma (CSCC) patients, the copy number variations (CNVs) of MIR30D were examined in both cancer tissues and adjacent normal tissues (ANTs) [PMC5372318]. MIR30D has been identified as a key regulator of human adipocyte development [PMC5701175]. Additionally, elevated expression of MIR30D and miR126 has been observed in patients with chronic total occlusion (CTO) compared to healthy individuals [PMC4558025].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCUAAGCUUUCAGUCAGAUGUUUGCUGCUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

2D structure Publications