v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-30d precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-30d precursor URS000036BDAF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR30D: MIR30D is a microRNA that has been studied in various contexts [PMC5372318]. In a study of cutaneous squamous cell carcinoma (CSCC) patients, the copy number variations (CNVs) of MIR30D were examined in both cancer tissues and adjacent normal tissues (ANTs) [PMC5372318]. MIR30D has been identified as a key regulator of human adipocyte development [PMC5701175]. Additionally, elevated expression of MIR30D and miR126 has been observed in patients with chronic total occlusion (CTO) compared to healthy individuals [PMC4558025].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCUAAGCUUUCAGUCAGAUGUUUGCUGCUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Balaenoptera musculus (Blue whale) microRNA 30d (ENSBMSG00010015911.1)
  2. Chlorocebus sabaeus microRNA 30d (ENSCSAG00000021324.1)
  3. Choloepus hoffmanni (Hoffmann's two-fingered sloth) miRNA (ENSCHOG00000014559.1)
  4. Gorilla gorilla gorilla ggo-mir-30d (ENSGGOG00000031886.2)
  5. Gorilla gorilla microRNA ggo-mir-30d precursor
  6. Macaca fascicularis microRNA 30d (ENSMFAG00000016375.2)
  7. Macaca mulatta (Macaque) mml-mir-30d (ENSMMUG00000027064.4)
  8. Macaca nemestrina microRNA mne-mir-30d precursor
  9. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 30d (ENSNLEG00000022320.2)
  10. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017403.1)
  11. Pan paniscus microRNA ppa-mir-30d precursor
  12. Pan troglodytes microRNA ptr-mir-30d precursor
  13. Pongo abelii miRNA (ENSPPYG00000022184.2)
  14. Pongo pygmaeus microRNA ppy-mir-30d precursor
  15. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000005493.1)
  16. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000008444.1)
  17. Rhinolophus ferrumequinum microRNA 30d (ENSRFEG00010019467.1)
 2D structure Publications