v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-30d precursor secondary structure diagram

Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-30d precursor URS000036BDAF_9597

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCUAAGCUUUCAGUCAGAUGUUUGCUGCUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Balaenoptera musculus (Blue whale) microRNA 30d (ENSBMSG00010015911.1)
  2. Chlorocebus sabaeus microRNA 30d (ENSCSAG00000021324.1)
  3. Choloepus hoffmanni (Hoffmann's two-fingered sloth) miRNA (ENSCHOG00000014559.1)
  4. Gorilla gorilla gorilla ggo-mir-30d (ENSGGOG00000031886.2)
  5. Gorilla gorilla (western gorilla) microRNA ggo-mir-30d precursor
  6. Homo sapiens microRNA hsa-mir-30d precursor
  7. Macaca fascicularis microRNA 30d (ENSMFAG00000016375.2)
  8. Macaca mulatta mml-mir-30d (ENSMMUG00000027064.4)
  9. Macaca nemestrina microRNA mne-mir-30d precursor
  10. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 30d (ENSNLEG00000022320.2)
  11. Otolemur garnettii (small-eared galago) microRNA 30d (ENSOGAG00000017403.1)
  12. Pan troglodytes (chimpanzee) microRNA ptr-mir-30d precursor
  13. Pongo abelii (Sumatran orangutan) microRNA 30d (ENSPPYG00000022184.2)
  14. Pongo pygmaeus microRNA ppy-mir-30d precursor
  15. Prolemur simus (greater bamboo lemur) microRNA 30d (ENSPSMG00000005493.1)
  16. Propithecus coquereli microRNA 30d (ENSPCOG00000008444.1)
  17. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 30d (ENSRFEG00010019467.1)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications