Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-361-5p URS00000CF1D2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-361: Hsa-mir-361 is a microRNA (miRNA) that has been implicated in various biological processes and diseases, including cancer and cardiovascular diseases [PMC8706837]. It is transcribed using specific RT primers in microRNA assays [PMC7998231], and its expression levels have been observed to be lower in tumor samples compared to normal samples [PMC8186776]. Hsa-mir-361 has not been extensively studied across different cancers, but its potential as a pan-cancer prognostic marker warrants further investigation [PMC6602415]. It is differentially expressed during pregnancy, with upregulation noted in the third trimester [PMC9700700], and significant upregulation observed in the first trimester among gestational diabetes mellitus (GDM) patients [PMC9700700]. In gastric cancer subtypes, hsa-mir-361 expression varies with tumor stage and nodal involvement [PMC4496000]. It has also been shown to enhance fusion capacity in myoblasts when overexpressed or when hsa-miR-98 is inhibited [PMC4325962]. Hsa-mir-361 serves as a protective miRNA in certain subtypes of glioblastoma multiforme (GBM) and has been used as an internal reference molecule for normalizing miRNA expression levels during quantitative RT-PCR analysis [PMC3917617], [PMC8473752], [PMC5348325]. Its expression profile differs between tumor tissue, where the 5p arm is dominant, and normal tissue where the 3p arm prevails [PMC3303722], indicating its potential involvement in disease progression as predicted by LE-MDCAP analysis tools for disease association prediction [PMC8706837].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUCAGAAUCUCCAGGGGUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Bos taurus (domestic cattle) bta-miR-361
  2. Callithrix jacchus cja-miR-361
  3. Canis lupus familiaris cfa-miR-361
  4. Capra hircus (goat) chi-miR-361-5p
  5. Cavia porcellus cpo-miR-361-5p
  6. Cervus elaphus cel-miR-361
  7. Cricetulus griseus (Chinese hamster) cgr-miR-361
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-361-5p
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-361-v1_5p (mature (guide))
  10. Eptesicus fuscus efu-miR-361
  11. Equus caballus (horse) eca-miR-361-5p
  12. Gorilla gorilla gorilla ggo-miR-361 (MIR361)
  13. Gorilla gorilla ggo-miR-361
  14. Loxodonta africana (African savanna elephant) Laf-Mir-361_5p (mature (guide))
  15. Macaca mulatta (Rhesus monkey) mml-miR-361-5p
  16. Microcebus murinus (gray mouse lemur) mmr-miR-361
  17. Mus musculus mmu-miR-361-5p
  18. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-361
  19. Oryctolagus cuniculus ocu-miR-361-5p
  20. Otolemur garnettii (small-eared galago) oga-miR-361
  21. Pongo abelii (Sumatran orangutan) Pab-Mir-361-v1_5p (mature (guide))
  22. Pongo pygmaeus (Bornean orangutan) ppy-miR-361-5p
  23. Pteropus alecto (black flying fox) pal-miR-361-5p
  24. Rattus norvegicus rno-miR-361-5p
  25. Sus scrofa ssc-miR-361-5p
Relationships

Molecular Relationships

GoFlow Results Publications