v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-361 URS00000CF1D2_9860

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUAUCAGAAUCUCCAGGGGUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Bos taurus (domestic cattle) bta-miR-361
  2. Callithrix jacchus cja-miR-361
  3. Canis lupus familiaris cfa-miR-361
  4. Capra hircus (goat) chi-miR-361-5p
  5. Cavia porcellus cpo-miR-361-5p
  6. Cricetulus griseus (Chinese hamster) cgr-miR-361
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-361-5p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-361-v1_5p (mature (guide))
  9. Eptesicus fuscus efu-miR-361
  10. Equus caballus (horse) eca-miR-361-5p
  11. Gorilla gorilla gorilla ggo-miR-361 (MIR361)
  12. Gorilla gorilla ggo-miR-361
  13. Homo sapiens hsa-miR-361-5p
  14. Loxodonta africana (African savanna elephant) Laf-Mir-361_5p (mature (guide))
  15. Macaca mulatta (Rhesus monkey) mml-miR-361-5p
  16. Microcebus murinus (gray mouse lemur) mmr-miR-361
  17. Mus musculus mmu-miR-361-5p
  18. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-361
  19. Oryctolagus cuniculus ocu-miR-361-5p
  20. Otolemur garnettii (small-eared galago) oga-miR-361
  21. Pongo abelii (Sumatran orangutan) Pab-Mir-361-v1_5p (mature (guide))
  22. Pongo pygmaeus (Bornean orangutan) ppy-miR-361-5p
  23. Pteropus alecto (black flying fox) pal-miR-361-5p
  24. Rattus norvegicus rno-miR-361-5p
  25. Sus scrofa ssc-miR-361-5p
 Relationships

Molecular Relationships