Mus caroli (Ryukyu mouse) microRNA 7-1 (MGP_CAROLIEiJ_G0007337.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus caroli (Ryukyu mouse) microRNA 7-1 (MGP_CAROLIEiJ_G0007337.1) URS000075EF96_10089

108 nucleotides
1 database (Ensembl)
Found in 7 other species
20 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UUGGAUGUUGGCCUAGUUCUGUGUGGAAGACUAGUGAUUUUGUUGUUUUUAGAUAACUAAAACGACAACAAAUCACAGUCUGCCAUAUGGCACAGGCCACCUCUACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Cricetulus griseus (Chinese hamster) miRNA (ENSCGRG00000021690.1, ENSCGRG00001003927.1, ENSCGRG00015015692.2)
Mus musculus microRNA mmu-mir-7a precursor (mmu-mir-7a-1)
Mus pahari microRNA 7-1 (MGP_PahariEiJ_G0006980.1)
Mus spicilegus (steppe mouse) miRNA (ENSMSIG00000004055.1, ENSMSIG00000020643.1)
Mus spretus microRNA 7-1 (MGP_SPRETEiJ_G0007688.1)
Nannospalax galili miRNA (ENSNGAG00000007030.1)
Peromyscus maniculatus bairdii (Northern American deer mouse) microRNA 7-1 (ENSPEMG00000003924.2)

Publications