Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 3138 (ENSGGOG00000039070.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 3138 (ENSGGOG00000039070.1) URS000075E93A_9595

82 nucleotides
2 databases (Ensembl, Rfam)
Found in 4 other species
32 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CCCUCCUCGGCACUUCCCCCACCUCACUGCCCGGGUGCCCACAAGACUGUGGACAGUGAGGUAGAGGGAGUGCCGAGGAGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Gorilla gorilla (western gorilla) mir-3138 microRNA precursor family
Homo sapiens microRNA hsa-mir-3138 precursor
Pan paniscus microRNA 3138 (ENSPPAG00000020170.1)
Pan troglodytes microRNA mir-3138 (ENSPTRG00000038931.2)

Publications