v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ursus maritimus (Polar bear) microRNA 205 (ENSUMAG00000021499.1) URS000075D739_29073

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCGUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bison bison bison microRNA 205 (ENSBBBG00000002982.1)
  2. Bos grunniens microRNA 205 (ENSBGRG00000024271.1)
  3. Bos indicus x Bos taurus miRNA (ENSBIXG00000001358.1, ENSBIXG00005022512.1)
  4. Bos mutus (wild yak) microRNA 205 (ENSBMUG00000006713.1)
  5. Bos taurus microRNA bta-mir-205 precursor
  6. Canis lupus dingo microRNA 205 (ENSCAFG00020013192.1)
  7. Canis lupus familiaris microRNA cfa-mir-205 precursor
  8. Felis catus (domestic cat) microRNA 205 (ENSFCAG00000016647.4)
  9. Lynx canadensis (Canada lynx) microRNA 205 (ENSLCNG00005017140.1)
  10. Panthera leo (lion) microRNA 205 (ENSPLOG00000020911.1)
  11. Pteropus vampyrus (large flying fox) microRNA 205 (ENSPVAG00000025291.1)
  12. Ursus americanus microRNA 205 (ENSUAMG00000022988.1)
  13. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 205 (ENSUTTG00000013703.1)
  14. Vulpes vulpes microRNA 205 (ENSVVUG00000009400.1)
 Publications