Anas platyrhynchos platyrhynchos (common mallard) microRNA 34a (ENSAPLG00000000135.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anas platyrhynchos platyrhynchos (common mallard) microRNA 34a (ENSAPLG00000000135.2) URS000075CFEB_8840

109 nucleotides
1 database (Ensembl)
Found in 12 other species
756 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUACACAUUGUUGGGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Anas platyrhynchos (mallard) microRNA 34a (ENSAPLG00020018092.1)
Anas zonorhyncha (Eastern spot-billed duck) miRNA (ENSAZOG00000014411.1)
Anser brachyrhynchus microRNA 34a (ENSABRG00000007782.1)
Anser cygnoides miRNA (ENSACDG00005010403.1)
Cairina moschata domestica (muscovy Duck (domestic type)) miRNA (ENSCMMG00000008577.1)
Chrysolophus pictus miRNA (ENSCPIG00010007855.1)
Coturnix japonica (Japanese quail) microRNA 34a (ENSCJPG00005011414.1)
Gallus gallus microRNA gga-mir-34a precursor
Meleagris gallopavo (turkey) microRNA 34a (ENSMGAG00000000492.2)
Numida meleagris microRNA 34a (ENSNMEG00000010816.1)
Phasianus colchicus microRNA 34a (ENSPCLG00000021908.1)

Publications