Mus caroli (Ryukyu mouse) microRNA let7a-2 (MGP_CAROLIEiJ_G0008260.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus caroli (Ryukyu mouse) microRNA let7a-2 (MGP_CAROLIEiJ_G0008260.1) URS000075C982_10089

96 nucleotides
1 database (Ensembl)
Found in 2 other species
2 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CUGCAUGUUCCCAGGUUGAGGUAGUAGGUUGUAUAGUUUAGAGUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCUUGGGACUUGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Mus musculus let-7a-2 stem-loop (mmu-let-7a-2)
Mus spretus (algerian mouse) microRNA let7a-2 (MGP_SPRETEiJ_G0008698.1)

Publications