Pongo abelii (Sumatran orangutan) microRNA 4691 (ENSPPYG00000036578.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo abelii (Sumatran orangutan) microRNA 4691 (ENSPPYG00000036578.1) URS000075C981_9601

85 nucleotides
2 databases (ENA, Ensembl)
Found in 1 other species
1 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GGAGCACUCCCAGGUCCUCCAGGCCAUGAGCUGCGGCCCUGAUGUCUCUACUCCAGCCACGGACUGAGAGUGCAUAGGAGUGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Homo sapiens microRNA hsa-mir-4691 precursor

Publications