Aotus nancymaae (Ma's night monkey) microRNA 363 (ENSANAG00000011007.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aotus nancymaae (Ma's night monkey) microRNA 363 (ENSANAG00000011007.1) URS000075BFFD_37293

75 nucleotides
1 database (Ensembl)
Found in 7 other species
37 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGUUGUCGGGUGGAUCACGAUGCAAUUUUGAUUAGUAUCAUAGGAGAAAAAUUGCACGGUAUCCAUCUGUAAACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Cercocebus atys microRNA 363 (ENSCATG00000020167.1)
Macaca mulatta microRNA mml-mir-363 precursor
Macaca nemestrina (Pig-tailed macaque) microRNA 363 (ENSMNEG00000017675.1)
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 363 (ENSNLEG00000026310.2)
Pongo abelii miRNA
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-363 precursor
Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 363 (ENSSBOG00000016046.1)

2D structure

Publications