v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo abelii (Sumatran orangutan) microRNA 3662 (ENSPPYG00000036665.1) URS000075BD9F_9601

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUGUUUUCCUCAACGCUCACAGUUACACUUCUUACUCUCAAUCCAUUCAUAUUGAAAAUGAUGAGUAGUGACUGAUGAAGCACAAAUCAGCCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Homo sapiens microRNA hsa-mir-3662 precursor
  2. Macaca fascicularis microRNA 3662 (ENSMFAG00000060980.1)
  3. Macaca mulatta microRNA 3662 (ENSMMUG00000055999.1)
  4. Pan troglodytes miRNA
  5. Papio anubis microRNA 3662 (ENSPANG00000042557.1)
  6. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 3662 (ENSPTEG00000022394.1)
  7. Theropithecus gelada (gelada) microRNA 3662 (ENSTGEG00000012978.1)
 Publications