Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-191 precursor URS000075BBD9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR191: MIR191 is a miRNA that has been found to have concentrations in patients with MHT, and it can provide additional information to improve indications for the need for an initial CCT scan [PMC7430915]. In a study, 36 miRNA orthologs were found to be mutually abundant between tumor types, and among them, MIR191 was one of the most notably expressed miRNA orthologs [PMC9210832]. The study used a circular heatmap in Figure-1 to present the expression levels of these miRNA orthologs [PMC9210832]. Additionally, four MEPNA for MIR191 were prepared with varying gap sizes (1-4 consecutive unmodified nucleotide units), with Amir-0 being an unmodified AO [PMC4005664]. These findings suggest that MIR191 is an important miRNA in the context of tumor types and can potentially be used as a biomarker for diagnostic purposes. Further research is needed to fully understand the role of MIR191 in these contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCAUUCCAGCUGCGCUUGGAUUUCGUCCCCUGCUCUCCUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

Publications