Cercocebus atys (Sooty mangabey) microRNA 449b (ENSCATG00000009645.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cercocebus atys (Sooty mangabey) microRNA 449b (ENSCATG00000009645.1) URS000075B9B1_9531

97 nucleotides
1 database (Ensembl)
Found in 9 other species
14 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGACCUGAAUCAGGUAGGCAGUGUAUUGUUAGCUGGCUGCUUGGGUCAAGUCAGCAGCCACAACUACCCUGCCACUUGCUUCUGGAUAAAUUCUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Chlorocebus sabaeus (African green monkey) microRNA 449b (ENSCSAG00000021148.1)
Gorilla gorilla gorilla microRNA 449b (ENSGGOG00000033893.2)
Homo sapiens microRNA hsa-mir-449b precursor
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 449b (ENSNLEG00000025316.2)
Pan paniscus (bonobo) microRNA 449b (ENSPPAG00000005830.1)
Pan troglodytes ptr-mir-449b (ENSPTRG00000028037.2)
Rhinopithecus bieti microRNA 449b (ENSRBIG00000006937.1)
Rhinopithecus roxellana microRNA 449b (ENSRROG00000037212.1)

2D structure

Publications