Callithrix jacchus (white-tufted-ear marmoset) microRNA 873 (ENSCJAG00000029386.4)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) microRNA 873 (ENSCJAG00000029386.4) URS0000759F2A_9483

110 nucleotides
1 database (Ensembl)
Found in 11 other species
18 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GAAUAAGUUUGUGUGCAUUUGCAGGAACUUGUGAGUCUCCUAUUGAAAAUGAACAGGAGACUGAUGAGUUCCCGGGAACACCCACAAAUCUUCCUACUCAUUUCUACUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

Chlorocebus sabaeus (African green monkey) microRNA 873 (ENSCSAG00000022855.1)
Gorilla gorilla gorilla microRNA mir-873 (MIR873)
Gorilla gorilla (western gorilla) microRNA ggo-mir-873 precursor
Macaca fascicularis microRNA 873 (ENSMFAG00000014922.2)
Macaca mulatta microRNA mml-mir-873 precursor
Papio anubis microRNA 873 (ENSPANG00000004456.3)
Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 873 (ENSPTEG00000016433.1)
Pongo abelii miRNA (ENSPPYG00000021398.2)
Theropithecus gelada (gelada) microRNA 873 (ENSTGEG00000011998.1)

Publications