Cricetulus griseus (Chinese hamster) microRNA mir-425 (ENSCGRG00000021197.1, ENSCGRG00001009143.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cricetulus griseus (Chinese hamster) microRNA mir-425 (ENSCGRG00000021197.1, ENSCGRG00001009143.1) URS00006EF746_10029

85 nucleotides
2 databases (Ensembl, Rfam)
Found in 9 other species
671 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAAGUGCUUUGGAAUGACACGAUCACUCCCGUUGAGUGGGCACCCAAGAAGCCAUCGGGAAUGUCGUGUCCGCCCAGUGCUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Capra hircus (goat) microRNA mir-425
Cavia porcellus microRNA 425 (ENSCPOG00000017448.3)
Ictidomys tridecemlineatus microRNA 425 (ENSSTOG00000016631.1)
Marmota monax (woodchuck) non-coding RNA
Microtus ochrogaster (vole) microRNA 425 (ENSMOCG00000006037.1)
Mus musculus (house mouse) microRNA mmu-mir-425 precursor
Mus pahari microRNA 425 (MGP_PahariEiJ_G0006700.1)
Mus spretus (algerian mouse) microRNA 425 (MGP_SPRETEiJ_G0008737.1)
Neotoma lepida (desert woodrat) microRNA mir-425

2D structure

Publications