Papio anubis (olive baboon) microRNA 516b-1 (ENSPANG00000040008.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Papio anubis (olive baboon) microRNA 516b-1 (ENSPANG00000040008.1) URS00006ACABB_9555

90 nucleotides
2 databases (Ensembl, Rfam)
Found in 11 other species
122 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UCUCAGGCUGUGACCAUCUGGAGGUAAGAAGCACUUUCUGUUUUGUGAAAGAAAAGAAAGUGCUUCCUUUCAGAGGGUUACUCUUUGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

Chlorocebus sabaeus (African green monkey) miRNA (ENSCSAG00000021780.1, ENSCSAG00000022521.1)
Gorilla gorilla gorilla microRNA 516b-1 (ENSGGOG00000037172.1)
Gorilla gorilla (western gorilla) mir-515 microRNA precursor family
Homo sapiens microRNA hsa-mir-516b precursor (hsa-mir-516b-1)
Macaca mulatta microRNA mml-mir-516b precursor
Macaca nemestrina (Pig-tailed macaque) microRNA 516b-1 (ENSMNEG00000010794.1)
Mandrillus leucophaeus (Drill) microRNA 516b-1 (ENSMLEG00000022407.1)
Pan paniscus (bonobo) microRNA 516b-1 (ENSPPAG00000008570.1)
Pongo abelii microRNA 516b-1 (ENSPPYG00000036369.1)
Pongo pygmaeus microRNA ppy-mir-516b precursor (ppy-mir-516b-1)
Theropithecus gelada microRNA 516b-1 (ENSTGEG00000006845.1)

Publications