v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gallus gallus (chicken) microRNA gga-mir-103 precursor (gga-mir-103-1) secondary structure diagram

Gallus gallus (chicken) microRNA gga-mir-103 precursor (gga-mir-103-1) URS000067FD39_9031

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGCUGCCUUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUACAGGGCUAUGAAGGCACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Chrysolophus pictus miRNA (ENSCPIG00010001436.1)
  2. Meleagris gallopavo miRNA (ENSMGAG00000000496.2)
  3. Phasianus colchicus miRNA (ENSPCLG00000008801.1)
  4. Polioptila caerulea mir-103/107 microRNA precursor family
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications