Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 598 (ENSNLEG00000022564.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 598 (ENSNLEG00000022564.2) URS0000669010_61853

97 nucleotides
1 database (Ensembl)
Found in 14 other species
10 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GCUUGAUGAUGCUGCUGAUGCUGGCGGUGAUCCCGAUGGUGUGAGCUGGAAAUGGGGUGCUACGUCAUCGUUGUCAUCGUCAUCAUCAUCAUCCGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

Chlorocebus sabaeus microRNA 598 (ENSCSAG00000025002.1)
Gorilla gorilla gorilla microRNA 598 (ENSGGOG00000028905.2)
Homo sapiens (human) microRNA hsa-mir-598 precursor
Macaca mulatta microRNA mml-mir-598 precursor
Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000004654.1)
Pan paniscus microRNA 598 (ENSPPAG00000006010.1)
Pan troglodytes (chimpanzee) ptr-mir-598 (ENSPTRG00000028097.3)
Pongo abelii miRNA
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-598 precursor
Rhinopithecus bieti miRNA (ENSRBIG00000001002.1)
Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 598 (ENSRROG00000020415.1)

Publications