v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 329-1 (ENSNLEG00000023226.2) secondary structure diagram

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 329-1 (ENSNLEG00000023226.2) URS0000668584_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUACCUGAAGAGAGGUUUUCUGGGUUUCUGUUUCUUUAAUGAGGACGAAACACACCUGGUUAACCUCUUUUCCAGUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Homo sapiens microRNA hsa-mir-329 precursor (hsa-mir-329-1)
  2. Pan paniscus microRNA 329-1 (ENSPPAG00000000538.1)
  3. Pan troglodytes ptr-mir-329-1 (ENSPTRG00000032084.2)
 2D structure Publications