v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-497 (ENSGGOG00000031795.2) URS000062BB4A_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCACCCCGGUCCUGCUCCCGCCCCAGCAGCACACUGUGGUUUGUACGGCACUGUGGCCACGUCCAAACCACACUGUGGUGUUAGAGCGAGGGUGGGGGAGGCACCGCCGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Cercocebus atys (Sooty mangabey) microRNA 497 (ENSCATG00000019690.1)
  2. Chlorocebus sabaeus microRNA 497 (ENSCSAG00000022887.1)
  3. Colobus angolensis palliatus miRNA (ENSCANG00000004029.1)
  4. Homo sapiens (human) microRNA hsa-mir-497 precursor
  5. Macaca fascicularis (Crab-eating macaque) microRNA 497 (ENSMFAG00000006193.2)
  6. Macaca mulatta (Rhesus monkey) microRNA mml-mir-497 precursor
  7. Macaca nemestrina microRNA 497 (ENSMNEG00000024520.1)
  8. Mandrillus leucophaeus (Drill) microRNA 497 (ENSMLEG00000009395.1)
  9. Nomascus leucogenys microRNA 497 (ENSNLEG00000022241.2)
  10. Papio anubis microRNA 497 (ENSPANG00000012272.3)
  11. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 497 (ENSPTEG00000017502.1)
  12. Rhinopithecus bieti (Black snub-nosed monkey) microRNA 497 (ENSRBIG00000019907.1)
  13. Rhinopithecus roxellana microRNA 497 (ENSRROG00000037475.1)
  14. Theropithecus gelada (gelada) microRNA 497 (ENSTGEG00000022180.1)
 Publications