Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000019121.1) secondary structure diagram

Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000019121.1) URS00005EB5B7_39432

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Aotus nancymaae miRNA (ENSANAG00000002894.1)
  2. Ateles geoffroyi (black-handed spider monkey) precursor microRNA let-7a-1
  3. Bos taurus let-7a-1 stem-loop (bta-let-7a-1)
  4. Capra hircus (Goat) microRNA let-7a-1 (ENSCHIG00000009519.1)
  5. Carlito syrichta miRNA (ENSTSYG00000021072.2)
  6. Cebus imitator (Panamanian white-faced capuchin) microRNA let-7a-1 (ENSCCAG00000005244.1)
  7. Cercocebus atys miRNA (ENSCATG00000010054.1)
  8. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000008020.1)
  9. Echinops telfairi miRNA (ENSETEG00000021920.1)
  10. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA let-7a-1 (ENSGGOG00000030966.2)
  11. Gorilla gorilla precursor microRNA let-7a-1
  12. Homo sapiens let-7a-1 stem-loop (hsa-let-7a-1)
  13. Lagothrix lagotricha (brown woolly monkey) precursor microRNA let-7a-1
  14. Lemur catta precursor microRNA let-7a-1
  15. Macaca mulatta let-7a-1 stem-loop (mml-let-7a-1)
  16. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000010971.1)
  17. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000004753.1)
  18. Microcebus murinus microRNA let-7a-1 (ENSMICG00000019650.3)
  19. Myotis lucifugus (little brown bat) miRNA (ENSMLUG00000018054.1)
  20. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA (ENSNLEG00000027736.1, ENSNLEG00000034490.1)
  21. Oryctolagus cuniculus ocu-let-7a-1 (ENSOCUG00000018323.1)
  22. Pan paniscus microRNA let-7a-1 (ENSPPAG00000007576.1)
  23. Panthera pardus (leopard) microRNA let-7a-1 (ENSPPRG00000013995.1)
  24. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000002647.1)
  25. Pan troglodytes ptr-let-7a-1 (ENSPTRG00000027844.4)
  26. Pongo abelii (Sumatran orangutan) miRNA
  27. Pongo pygmaeus let-7a-1 stem-loop (ppy-let-7a-1)
  28. Propithecus coquereli miRNA (ENSPCOG00000011738.1)
  29. Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000025480.1)
  30. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000007863.1)
  31. Rhinopithecus roxellana miRNA (ENSRROG00000024057.1)
  32. Saguinus labiatus (red-chested mustached tamarin) precursor microRNA let-7a-1
  33. Sorex araneus (European shrew) miRNA (ENSSARG00000016564.1)
  34. Suricata suricatta microRNA let-7a-1 (ENSSSUG00005021949.1)
  35. Tursiops truncatus miRNA (ENSTTRG00000022643.1)
  36. Vicugna pacos miRNA (ENSVPAG00000016957.1)
Relationships New

Molecular Relationships

2D structure

Loading 2D structure...