v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000008020.1) secondary structure diagram

Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000008020.1) URS00005EB5B7_336983

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Aotus nancymaae miRNA (ENSANAG00000002894.1)
  2. Ateles geoffroyi (black-handed spider monkey) precursor microRNA let-7a-1
  3. Bos taurus let-7a-1 stem-loop (bta-let-7a-1)
  4. Capra hircus (Goat) microRNA let-7a-1 (ENSCHIG00000009519.1)
  5. Carlito syrichta miRNA (ENSTSYG00000021072.2)
  6. Cebus imitator (Panamanian white-faced capuchin) microRNA let-7a-1 (ENSCCAG00000005244.1)
  7. Cercocebus atys miRNA (ENSCATG00000010054.1)
  8. Echinops telfairi miRNA (ENSETEG00000021920.1)
  9. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA let-7a-1 (ENSGGOG00000030966.2)
  10. Gorilla gorilla precursor microRNA let-7a-1
  11. Homo sapiens let-7a-1 stem-loop (hsa-let-7a-1)
  12. Lagothrix lagotricha (brown woolly monkey) precursor microRNA let-7a-1
  13. Lemur catta precursor microRNA let-7a-1
  14. Macaca mulatta let-7a-1 stem-loop (mml-let-7a-1)
  15. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000010971.1)
  16. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000004753.1)
  17. Microcebus murinus microRNA let-7a-1 (ENSMICG00000019650.3)
  18. Myotis lucifugus (little brown bat) miRNA (ENSMLUG00000018054.1)
  19. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA (ENSNLEG00000027736.1, ENSNLEG00000034490.1)
  20. Oryctolagus cuniculus ocu-let-7a-1 (ENSOCUG00000018323.1)
  21. Pan paniscus microRNA let-7a-1 (ENSPPAG00000007576.1)
  22. Panthera pardus (leopard) microRNA let-7a-1 (ENSPPRG00000013995.1)
  23. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000002647.1)
  24. Pan troglodytes ptr-let-7a-1 (ENSPTRG00000027844.4)
  25. Pongo abelii (Sumatran orangutan) miRNA
  26. Pongo pygmaeus let-7a-1 stem-loop (ppy-let-7a-1)
  27. Propithecus coquereli miRNA (ENSPCOG00000011738.1)
  28. Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000025480.1)
  29. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000007863.1)
  30. Rhinopithecus roxellana miRNA (ENSRROG00000024057.1)
  31. Saguinus labiatus (red-chested mustached tamarin) precursor microRNA let-7a-1
  32. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000019121.1)
  33. Sorex araneus (European shrew) miRNA (ENSSARG00000016564.1)
  34. Suricata suricatta microRNA let-7a-1 (ENSSSUG00005021949.1)
  35. Tursiops truncatus miRNA (ENSTTRG00000022643.1)
  36. Vicugna pacos miRNA (ENSVPAG00000016957.1)
 Relationships New

Molecular Relationships

 2D structure

Loading 2D structure...