Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Glycine max (soybean) gma-miR390f URS00005C2DB4_3847

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUCAGGAGGGAUAGCGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Aegilops tauschii ata-miR390-5p
  2. Amborella trichopoda atr-miR390.2
  3. Ananas comosus miR390
  4. Arabidopsis lyrata (lyrate rockcress) aly-miR390b-5p
  5. Arabidopsis thaliana (thale cress) ath-miR390a-5p
  6. Asparagus officinalis (garden asparagus) aof-miR390
  7. Brachypodium distachyon bdi-miR390a-5p
  8. Brassica napus (rape) bna-miR390a
  9. Brassica rapa (field mustard) bra-miR390-5p
  10. Camelina sativa (false flax) cas-miR390b
  11. Carica papaya cpa-miR390b
  12. Citrus sinensis (sweet orange) csi-miR390a-5p
  13. Corchorus capsularis sRNA CCACVL1_11672
  14. Corchorus olitorius aly-miR390a-
  15. Cucumis melo cme-miR390a
  16. Fragaria vesca subsp. vesca fve-miR390b
  17. Gossypium hirsutum (cotton) ghr-miR390b
  18. Helianthus annuus ath-miR390a-5p
  19. Helianthus exilis hex-miR390b
  20. Linum usitatissimum (flax) lus-miR390c
  21. Lotus japonicus lja-miR390b-5p
  22. Malus domestica (apple) mdm-miR390f
  23. Manihot esculenta mes-miR390b
  24. Medicago truncatula (barrel medic) mtr-miR390
  25. Moringa oleifera (horseradish tree) novel_miR_145
  26. Mus musculus (house mouse) rco-miR390a
  27. Nicotiana tabacum nta-miR390b
  28. Oryza sativa (Asian cultivated rice) osa-miR390-5p
  29. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR390-5p
  30. Physcomitrium patens ppt-miR390b
  31. Picea abies (Norway spruce) pab-miR390a
  32. Populus tomentosa Pto-miR390b
  33. Populus trichocarpa ptc-miR390d-5p
  34. Prunus persica ppe-miR390
  35. Ricinus communis (castor bean) rco-miR390b
  36. Solanum lycopersicum sly-miR390b-5p
  37. Sorghum bicolor (sorghum) sbi-miR390
  38. Theobroma cacao (cacao) tcc-miR390a
  39. Vitis vinifera (wine grape) vvi-miR390
  40. Zea mays (maize) zma-miR390b-5p
Relationships

Molecular Relationships

Publications