v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Vitis vinifera (wine grape) vvi-miR390 URS00005C2DB4_29760

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAGCUCAGGAGGGAUAGCGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Aegilops tauschii ata-miR390-5p
  2. Amborella trichopoda atr-miR390.2
  3. Ananas comosus miR390
  4. Arabidopsis lyrata (lyrate rockcress) aly-miR390b-5p
  5. Arabidopsis thaliana (thale cress) ath-miR390a-5p
  6. Asparagus officinalis (garden asparagus) aof-miR390
  7. Brachypodium distachyon bdi-miR390a-5p
  8. Brassica napus (rape) bna-miR390a
  9. Brassica rapa (field mustard) bra-miR390-5p
  10. Camelina sativa (false flax) cas-miR390b
  11. Carica papaya cpa-miR390b
  12. Citrus sinensis (sweet orange) csi-miR390a-5p
  13. Corchorus capsularis sRNA CCACVL1_11672
  14. Corchorus olitorius aly-miR390a-
  15. Cucumis melo cme-miR390a
  16. Fragaria vesca subsp. vesca fve-miR390b
  17. Glycine max (soybean) gma-miR390f
  18. Gossypium hirsutum (cotton) ghr-miR390b
  19. Helianthus annuus ath-miR390a-5p
  20. Helianthus exilis hex-miR390b
  21. Linum usitatissimum (flax) lus-miR390c
  22. Lotus japonicus lja-miR390b-5p
  23. Malus domestica (apple) mdm-miR390f
  24. Manihot esculenta mes-miR390b
  25. Medicago truncatula (barrel medic) mtr-miR390
  26. Moringa oleifera (horseradish tree) novel_miR_145
  27. Mus musculus (house mouse) rco-miR390a
  28. Nicotiana tabacum nta-miR390b
  29. Oryza sativa (Asian cultivated rice) osa-miR390-5p
  30. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR390-5p
  31. Physcomitrium patens ppt-miR390b
  32. Picea abies (Norway spruce) pab-miR390a
  33. Populus tomentosa Pto-miR390b
  34. Populus trichocarpa ptc-miR390d-5p
  35. Prunus persica ppe-miR390
  36. Ricinus communis (castor bean) rco-miR390b
  37. Solanum lycopersicum sly-miR390b-5p
  38. Sorghum bicolor (sorghum) sbi-miR390
  39. Theobroma cacao (cacao) tcc-miR390a
  40. Zea mays (maize) zma-miR390b-5p
 Relationships

Molecular Relationships

 Publications