v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rhinopithecus bieti (Black snub-nosed monkey) microRNA 186 (ENSRBIG00000007314.1, ENSRBIG00000007337.1) URS000059EAAC_61621

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGCUUGUAACUUUCCAAAGAAUUCUCCUUUUGGGCUUUCUGGUUUUAUUUUAAGCCCAAAGGUGAAUUUUUUGGGAAGUUUGAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-mir-186 (ENSCJAG00000027274.3)
  2. Cebus imitator microRNA 186 (ENSCCAG00000004045.1)
  3. Chlorocebus sabaeus microRNA 186 (ENSCSAG00000023352.1)
  4. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000007500.1)
  5. Gorilla gorilla gorilla ggo-mir-186 (ENSGGOG00000033554.2)
  6. Gorilla gorilla (western gorilla) microRNA ggo-mir-186 precursor
  7. Homo sapiens (human) microRNA hsa-mir-186 precursor
  8. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 186 (ENSNLEG00000024746.2)
  9. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-186 precursor
  10. Pan troglodytes microRNA ptr-mir-186 precursor
  11. Piliocolobus tephrosceles microRNA 186 (ENSPTEG00000035802.1)
  12. Pongo abelii microRNA 186 (ENSPPYG00000022043.2)
  13. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-186 precursor
  14. Rhinopithecus roxellana microRNA 186 (ENSRROG00000019117.1)
 Publications