Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila mojavensis dmo-bantam URS00004E9E38_7230

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAUCAUUUUGAAAGCUGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Aedes aegypti Aae-Bantam_3p (mature (guide))
  2. Cochliomyia hominivorax (primary screw-worm) mature cho-bantam-3p
  3. Cochliomyia macellaria (secondary screw-worm) mature cma-bantam-3p
  4. Drosophila ananassae dan-bantam
  5. Drosophila erecta der-bantam
  6. Drosophila grimshawi dgr-bantam
  7. Drosophila melanogaster dme-bantam-3p
  8. Drosophila persimilis dpe-bantam
  9. Drosophila pseudoobscura dps-bantam
  10. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294525_df_nrg
  11. Drosophila sechellia dse-bantam
  12. Drosophila simulans dsi-bantam
  13. Drosophila virilis dvi-bantam-3p
  14. Drosophila willistoni dwi-bantam
  15. Drosophila yakuba dya-bantam
Publications