v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-2188_5p (mature (guide)) URS00004CF6E6_99883

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAGGUCCAACCUCACAUGUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Alligator mississippiensis Ami-Mir-2188_5p (mature (guide))
  2. Chrysemys picta bellii Cpi-Mir-2188_5p (mature (guide))
  3. Chrysemys picta (Painted turtle) cpi-miR-2188-5p
  4. Columba livia (rock pigeon) Cli-Mir-2188_5p (mature (guide))
  5. Danio rerio Dre-Mir-2188_5p (mature (guide))
  6. Gadus morhua gmo-miR-2188-5p
  7. Gallus gallus gga-miR-2188-5p
  8. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-2188
  9. Latimeria chalumnae (coelacanth) Lch-Mir-2188_5p (mature (guide))
  10. Lepisosteus oculatus (spotted gar) Loc-Mir-2188_5p (mature (guide))
  11. Maylandia zebra mze-miR-2188
  12. Microcaecilia unicolor Mun-Mir-2188_5p (mature (guide))
  13. Monopterus albus (swamp eel) Mal-Mir-2188_5p (mature (guide))
  14. Neolamprologus brichardi (lyretail cichlid) nbr-miR-2188
  15. Oreochromis niloticus oni-miR-2188
  16. Pundamilia nyererei pny-miR-2188
  17. Salmo salar ssa-miR-2188-5p
  18. Sphenodon punctatus Spt-Mir-2188_5p (mature (guide))
  19. Taeniopygia guttata (zebra finch) tgu-miR-2188-5p