v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-2188-5p URS00004CF6E6_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-2188: Gga-mir-2188 is a miRNA that has not been implicated in the regulation of muscle development [PMC3107184]. In dwarf chickens, gga-mir-2188 was significantly downregulated in the adipose tissue [PMC7936154]. It was also found to be present in both yolk and albumen [PMC4877990]. The mouse and zebrafish counterparts of gga-mir-2188 have been shown to be involved in the development of the vascular system and hematopoiesis in embryos [PMC4877990]. The relative expression of gga-mir-2188 was significantly higher in yolk compared to albumen [PMC4877990]. In a study on fat broiler lines, gga-mir-2188 was classified as moderately expressed [PMC4326283]. Overall, gga-mir-2188 has not been extensively studied, but its expression patterns suggest potential roles in adipose tissue regulation and embryonic development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAGGUCCAACCUCACAUGUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Alligator mississippiensis Ami-Mir-2188_5p (mature (guide))
  2. Chrysemys picta bellii Cpi-Mir-2188_5p (mature (guide))
  3. Chrysemys picta (Painted turtle) cpi-miR-2188-5p
  4. Columba livia (rock pigeon) Cli-Mir-2188_5p (mature (guide))
  5. Danio rerio Dre-Mir-2188_5p (mature (guide))
  6. Gadus morhua gmo-miR-2188-5p
  7. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-2188
  8. Latimeria chalumnae (coelacanth) Lch-Mir-2188_5p (mature (guide))
  9. Lepisosteus oculatus (spotted gar) Loc-Mir-2188_5p (mature (guide))
  10. Maylandia zebra mze-miR-2188
  11. Microcaecilia unicolor Mun-Mir-2188_5p (mature (guide))
  12. Monopterus albus (swamp eel) Mal-Mir-2188_5p (mature (guide))
  13. Neolamprologus brichardi (lyretail cichlid) nbr-miR-2188
  14. Oreochromis niloticus oni-miR-2188
  15. Pundamilia nyererei pny-miR-2188
  16. Salmo salar ssa-miR-2188-5p
  17. Sphenodon punctatus Spt-Mir-2188_5p (mature (guide))
  18. Taeniopygia guttata (zebra finch) tgu-miR-2188-5p
  19. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-2188_5p (mature (guide))
 Publications