v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-22 precursor URS00003A4D14_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR22: MIR22 is a microRNA that has been studied in relation to various biological processes. In a study conducted on U251 and EA.hy926 cells, the knockdown of RPL29 using siRNA, followed by poly(I:C) treatment, resulted in the quantification of MIR22 using qRT-PCR [PMC7530758]. The study found that the differential expression of MIR22 can regulate inflammation induced by the transmissible gastroenteritis virus in intestinal porcine epithelial cells [PMC7530758]. Another study observed that low expression of MIR22 was associated with poor prognosis in patients with hepatocellular carcinoma [PMC9284388]. However, further research is needed to fully understand the regulatory pathways through which RPL29 influences MIR22 expression [PMC7530758]. These findings highlight the potential role of MIR22 in inflammation and disease progression and emphasize the need for further investigation to elucidate its mechanisms of action.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCUGAGCCGCAGUAGUUCUUCAGUGGCAAGCUUUAUGUCCUGACCCAGCUAAAGCUGCCAGUUGAAGAACUGUUGCCCUCUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Ailuropoda melanoleuca mir-22
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-22 precursor
  3. Bos taurus microRNA bta-mir-22 precursor
  4. Capra hircus microRNA mir-22 (ENSCHIG00000009214.1)
  5. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000019768.2)
  6. Cercocebus atys miRNA (ENSCATG00000008898.1)
  7. Colobus angolensis palliatus miRNA (ENSCANG00000005919.1)
  8. Dasypus novemcinctus (nine-banded armadillo) microRNA 22 (ENSDNOG00000028846.1)
  9. Equus caballus microRNA eca-mir-22 precursor
  10. Gorilla gorilla gorilla microRNA 22 (ENSGGOG00000029560.2)
  11. Lagothrix lagotricha microRNA lla-mir-22 precursor
  12. Lemur catta microRNA lca-mir-22 precursor
  13. Macaca mulatta (Rhesus monkey) microRNA mml-mir-22 precursor
  14. Macaca nemestrina microRNA mne-mir-22 precursor
  15. Mandrillus leucophaeus miRNA (ENSMLEG00000003004.1)
  16. Marmota monax (woodchuck) non-coding RNA
  17. Microcebus murinus microRNA 22 (ENSMICG00000019565.3)
  18. Mustela putorius furo (Domestic ferret) microRNA 22 (ENSMPUG00000020709.1)
  19. Myotis lucifugus microRNA 22 (ENSMLUG00000017946.1)
  20. Neogale vison microRNA 22 (ENSNVIG00000010566.1)
  21. Nomascus leucogenys microRNA 22 (ENSNLEG00000022919.2)
  22. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017367.1)
  23. Ovis aries microRNA oar-mir-22 precursor
  24. Pan paniscus microRNA ppa-mir-22 precursor
  25. Panthera pardus (leopard) microRNA 22 (ENSPPRG00000014363.1)
  26. Panthera tigris altaica miRNA (ENSPTIG00000001915.1)
  27. Pan troglodytes (chimpanzee) microRNA ptr-mir-22 precursor
  28. Pongo abelii miRNA
  29. Pongo pygmaeus microRNA ppy-mir-22 precursor
  30. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000009993.1)
  31. Rhinopithecus roxellana miRNA (ENSRROG00000027294.1)
 Publications