Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis lyrata (lyrate rockcress) aly-miR396a-5p URS000039FDDC_59689

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

aly-mir396a-5p: Aly-mir396a-5p is a microRNA (miRNA) found in ginger exosome-like nanoparticles (GELNs) and is present in the tissues of edible plants [PMC10047465]. This miRNA, when encapsulated in ginger-derived lipid vesicles (GDLVs), has been shown to suppress the cytopathic effect of SARS-CoV-2 by inhibiting the expression of the viral Nsp12 gene [PMC9338735]. Aly-mir396a-5p has been developed to target lung inflammation, as it effectively inhibits NF-κB-mediated inflammation and apoptosis in lung tissues [PMC9941074], [PMC9028404]. The transfection efficiency of aly-mir396a-5p is higher when delivered by GDLVs compared to other transfection agents, except RNAiMAX, in A549 cells [PMC9319657]. The miRNA's therapeutic potential is highlighted by its ability to target viral genes without affecting host genes, thus not disturbing the host's immune response [PMC8619171], [PMC9249409]. Aly-mir396a-5p's role in inhibiting viral replication and inflammation has been confirmed through various studies, demonstrating its ability to reduce expression levels of SARS-CoV-2 proteins and inflammatory cytokines when delivered effectively to lung tissue via GDLVs [PMC8590742], [PMC10053153], [PMC8110335].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCACAGCUUUCUUGAACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Acacia auriculiformis aau-miR396
  2. Acacia mangium amg-miR396
  3. Aegilops tauschii ata-miR396e-5p
  4. Ananas comosus vvi-miR396d
  5. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR396a
  6. Arabidopsis thaliana (thale cress) ath-miR396a-5p
  7. Asparagus officinalis aof-miR396b
  8. Brachypodium distachyon bdi-miR396d-5p
  9. Bruguiera cylindrica bcy-miR396a
  10. Bruguiera gymnorhiza (Burma mangrove) bgy-miR396a
  11. Camelina sativa cas-miR396a
  12. Carica papaya cpa-miR396
  13. Citrus sinensis csi-miR396b-5p
  14. Cucumis melo (muskmelon) cme-miR396b
  15. Digitalis purpurea (common foxglove) dpr-miR396
  16. Eugenia uniflora (Brazil-cherry) eun-miR396b-5p
  17. Fragaria vesca subsp. vesca fve-miR396a-5p
  18. Glycine max gma-miR396i-5p
  19. Gossypium hirsutum ghr-miR396a
  20. Helianthus annuus (common sunflower) ath-miR396a-5p
  21. Hevea brasiliensis hbr-miR396b
  22. Linum usitatissimum lus-miR396c
  23. Lotus japonicus lja-miR396
  24. Malus domestica mdm-miR396b
  25. Manihot esculenta (cassava) mes-miR396b
  26. Medicago truncatula mtr-miR396b-5p
  27. Moringa oleifera (horseradish tree) novel_miR_192
  28. Nicotiana attenuata microRNA mir-396-like
  29. Nicotiana tabacum (common tobacco) nta-miR396a
  30. Oryza sativa (Asian cultivated rice) osa-miR396b-5p
  31. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR396b-5p
  32. Populus tomentosa Pto-miR396b
  33. Populus trichocarpa ptc-miR396b
  34. Rosa chinensis ath-miR396a-5p
  35. Saccharum officinarum (sugarcane) sof-miR396
  36. Saccharum sp. ssp-miR396
  37. Salvia sclarea (clary) ssl-miR396
  38. Solanum lycopersicum sly-miR396a-5p
  39. Sorghum bicolor sbi-miR396b
  40. Theobroma cacao (cacao) tcc-miR396a
  41. Vitis vinifera vvi-miR396d
  42. Zea mays (maize) zma-miR396a-5p
Relationships

Molecular Relationships

Publications