v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Takifugu rubripes (torafugu) fru-let-7g URS0000396EA1_31033

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGGUAGUAGUUUGUAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Cyprinus carpio ccr-let-7g
  2. Danio rerio dre-let-7g
  3. Gadus morhua gmo-let-7g-5p
  4. Gallus gallus microRNA let-7g
  5. Haplochromis burtoni (Burton's mouthbrooder) abu-let-7g
  6. Ictalurus punctatus (channel catfish) ipu-let-7g
  7. Lepisosteus oculatus (spotted gar) Loc-Let-7-P2a3_5p (mature (guide))
  8. Maylandia zebra (zebra mbuna) mze-let-7g
  9. Monopterus albus Mal-Let-7-P2a3b_5p (mature (guide))
  10. Mus musculus Mus_musculus piRNA piR-mmu-10842452
  11. Neolamprologus brichardi (lyretail cichlid) nbr-let-7g
  12. Oreochromis niloticus oni-let-7g
  13. Pundamilia nyererei pny-let-7g
  14. Salmo salar ssa-let-7g-5p
  15. Tetraodon nigroviridis tni-let-7g
  16. Tor tambroides let-7g
 Publications