Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-30d precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-30d precursor URS000036BDAF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir30d: MIR30D is a microRNA that plays a significant role in the regulation of human adipocyte development [PMC5701175]. In a study involving 136 matched samples from CSCC patients, the copy number variations (CNVs) of MIR30D were analyzed in both cancer tissues and adjacent normal tissues (ANTs) [PMC5372318]. This analysis is crucial as it helps to understand the genetic alterations associated with cancer progression. Furthermore, MIR30D has been found to have increased expression in patients with chronic thromboembolic obstruction (CTO) when compared to healthy individuals, indicating its potential involvement in pathological conditions beyond adipocyte development [PMC4558025]. This elevated expression of MIR30D, along with miR126, suggests that it may have diagnostic or therapeutic implications for CTO and possibly other diseases.

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCUAAGCUUUCAGUCAGAUGUUUGCUGCUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression GoFlow Results Publications