v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anolis carolinensis (green anole) aca-miR-302b URS0000346991_28377

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAAGUGCUUCCAUGUUUUAGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-430-P1_3p (mature (guide))
  2. Bos taurus (cattle) bta-miR-302b
  3. Canis lupus familiaris (dog) Cfa-Mir-430-P1_3p (mature (guide))
  4. Cavia porcellus cpo-miR-302b-3p
  5. Chrysemys picta bellii (western painted turtle) Cpi-Mir-430-P1_3p (mature (guide))
  6. Chrysemys picta cpi-miR-302b-3p
  7. Columba livia Cli-Mir-430-P1_3p (mature (guide))
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-302b-3p
  9. Equus caballus eca-miR-302b
  10. Gallus gallus (chicken) gga-miR-302b-3p
  11. Homo sapiens (human) hsa-miR-302b-3p
  12. Macaca mulatta mml-miR-302b
  13. Mus musculus mmu-miR-302b-3p
  14. Ornithorhynchus anatinus Oan-Mir-430-P1_3p (mature (guide))
  15. Pan troglodytes (chimpanzee) ptr-miR-302b
  16. Pongo pygmaeus (Bornean orangutan) ppy-miR-302b
  17. Sphenodon punctatus (tuatara) Spt-Mir-430-P1_3p (mature (guide))
  18. Taeniopygia guttata Tgu-Mir-430-P1_3p (mature (guide))
 Publications