Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-122 URS00003380CC_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-122: Bta-mir-122 is a bovine microRNA that was analyzed using the TaqMan Small RNA Assay kit [PMC9051433]. The kit specifically targeted has-miR-122-5p, which has the same sequence as bta-mir-122 [PMC9051433]. The results of the analysis revealed that bta-mir-122 was the third most expressed microRNA in bovine samples, accounting for approximately 8% of the total known bovine microRNA population [PMC5003961].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGUGUGACAAUGGUGUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Alligator mississippiensis (American alligator) ami-miR-122-5p
  2. Anolis carolinensis aca-miR-122-5p
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-122
  4. Canis lupus familiaris (dog) cfa-miR-122
  5. Capra hircus chi-miR-122
  6. Cavia porcellus cpo-miR-122-5p
  7. Cervus elaphus (red deer) cel-miR-122
  8. Chrysemys picta bellii Cpi-Mir-122_5p (mature (guide))
  9. Chrysemys picta cpi-miR-122-5p
  10. Columba livia (rock pigeon) cli-miR-122-5p
  11. Danio rerio dre-miR-122
  12. Dasypus novemcinctus dno-miR-122-5p
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-122_5p (mature (guide))
  14. Eptatretus burgeri (inshore hagfish) Ebu-Mir-122-P3_5p (mature (guide))
  15. Equus caballus (horse) eca-miR-122
  16. Gadus morhua gmo-miR-122-5p
  17. Gallus gallus (chicken) Gga-Mir-122-P1_5p (mature (guide))
  18. Gekko japonicus Gja-Mir-122_5p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-122 (MIR122)
  20. Gorilla gorilla ggo-miR-122
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-122
  22. Homo sapiens hsa-miR-122-5p
  23. Macaca mulatta mml-miR-122a-5p
  24. Maylandia zebra mze-miR-122
  25. Microcaecilia unicolor Mun-Mir-122_5p (mature (guide))
  26. Monopterus albus Mal-Mir-122_5p (mature (guide))
  27. Mus musculus mmu-miR-122-5p
  28. Neolamprologus brichardi (lyretail cichlid) nbr-miR-122
  29. Oreochromis niloticus (Nile tilapia) oni-miR-122
  30. Ornithorhynchus anatinus (platypus) oan-miR-122-5p
  31. Oryctolagus cuniculus (rabbit) ocu-miR-122-5p
  32. Pan troglodytes (chimpanzee) ptr-miR-122
  33. Paralichthys olivaceus (Japanese flounder) pol-miR-122-5p
  34. Pongo pygmaeus ppy-miR-122
  35. Pteropus alecto pal-miR-122-5p
  36. Pundamilia nyererei pny-miR-122
  37. Python bivittatus (Burmese python) pbv-miR-122-5p
  38. Rattus norvegicus rno-miR-122-5p
  39. Salmo salar ssa-miR-122-5p
  40. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-122_5p (mature (guide))
  41. Sphenodon punctatus Spt-Mir-122_5p (mature (guide))
  42. Taeniopygia guttata (zebra finch) tgu-miR-122-5p
  43. Takifugu rubripes fru-miR-122
  44. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-122
  45. Tor tambroides miR-122
  46. Tursiops truncatus miR-122-5p
  47. Xenopus laevis Xla-Mir-122-P6_5p (mature (guide))
  48. Xenopus tropicalis Xtr-Mir-122_5p (mature (guide))
Publications