Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-130b URS00002C0FCB_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-130b: cfa-mir-130b, a microRNA, has been identified as a more accurate biomarker than NT-proBNP for distinguishing dogs with various heart diseases from healthy dogs, particularly in MMVD stage B, PDA, and PS groups [PMC8542680]. It is significantly upregulated in these groups and shows a strong positive correlation with heart rate, NT-proBNP levels, and LA/Ao ratio in MMVD stage B [PMC8542680]. The upregulation of cfa-mir-130b is consistent across different types of cardiac hypertrophy and may reflect common pathophysiological changes induced by heart diseases [PMC8542680]. Despite its potential as an early diagnostic biomarker for cardiac conditions in dogs, cfa-mir-130b's specific target genes and pathways remain to be elucidated [PMC8542680]. Furthermore, its expression does not significantly change in advanced stages of MMVD (stages C and D), suggesting that it may not be a reliable marker across all stages of the disease [PMC8542680]. However, the consistent upregulation of cfa-mir-130b in early disease stages underscores its potential utility for early detection and monitoring of canine heart diseases [PMC8542680].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCAAUGAUGAAAGGGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

Relationships New

Molecular Relationships

Publications