v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-130b-3p URS00002C0FCB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-130b: Hsa-mir-130b is a microRNA that, unlike some others, does not cluster with the main groups identified in a study of B-ALL patients [PMC3078861]. This particular miRNA is of significant interest due to its strong association with patient outcomes; it was the most significant miRNA in the study, with a p-value of less than 0.0001 [PMC9624360]. Hsa-mir-130b was found to be downregulated by IK1, which is noteworthy because its higher expression levels were correlated with poorer overall outcomes in patients suffering from B-ALL [PMC9624360]. This microRNA was among several others that were differentially expressed; some were upregulated while others were downregulated, indicating a complex pattern of gene expression changes associated with the disease [PMC10048937].

mRNA interactions 12 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGUGCAAUGAUGAAAGGGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Bos taurus (domestic cattle) bta-miR-130b
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-130b
  3. Canis lupus familiaris cfa-miR-130b
  4. Capra hircus chi-miR-130b-3p
  5. Cavia porcellus cpo-miR-130b-3p
  6. Cricetulus griseus cgr-miR-130b-3p
  7. Dasypus novemcinctus dno-miR-130b-3p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-130-P4a_3p (mature (guide))
  9. Equus caballus eca-miR-130b
  10. Loxodonta africana (African savanna elephant) Laf-Mir-130-P4a_3p (mature (guide))
  11. Macaca mulatta (Rhesus monkey) mml-miR-130b-3p
  12. Microcebus murinus (gray mouse lemur) Mmr-Mir-130-P4a_3p (mature (guide))
  13. Mus musculus (house mouse) mmu-miR-130b-3p
  14. Oryctolagus cuniculus ocu-miR-130b-3p
  15. Pan troglodytes (chimpanzee) ptr-miR-130b
  16. Pongo abelii (Sumatran orangutan) Pab-Mir-130-P4a_3p (mature (co-guide))
  17. Pongo pygmaeus ppy-miR-130b
  18. Rattus norvegicus (Norway rat) rno-miR-130b-3p
  19. Sus scrofa ssc-miR-130b-3p
  20. Xenopus laevis xla-miR-130b-3p
  21. Xenopus tropicalis (tropical clawed frog) xtr-miR-130b
 Relationships New

Molecular Relationships

 GoFlow Results Publications