Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-885 URS0000246356_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-885: Cfa-mir-885 is a microRNA that was evaluated in a study along with other miRNAs such as cfa-miR-122, cfa-miR-1, cfa-miR-133a, cfa-miR-208b, cfa-miR-499, cfa-miR-206, cfa-miR-212, cfa-miR-432, cfa-miR-34b/c, cfa-miR-216a/b, and others [PMC4989286]. It was found that miRNA cfa-mir-885 is predicted to regulate the IGSF3 gene [PMC7689213]. Additionally, it was observed that at the initial stage of infection with T. canis (12 hpi), both novel-294 and cfa-mir-885 were differentially expressed [PMC7689213]. The study suggests that CFA-MIR885 plays a protective role during T. canis infection [PMC7689213]. Furthermore, in a network analysis of miRNAs and transcription factors involved in the elevation of transforming growth factor beta transcript (TGFβ), it was found that there is an interplay between miRNAs such as CFA-MIR885 and transcription factors like Sp1 and RelA [PMC3668254]. Additionally, there were moderate inverse correlations between plasma PIIINP concentration and microRNAs including CFA-MIR885 [PMC3668254]. The expression of CFA-MIR885 was significantly decreased from day 11 in the study [PMC3668254].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAUUACACUACCCUGCCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus (cattle) bta-miR-885
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-885
  3. Dasypus novemcinctus dno-miR-885-5p
  4. Equus caballus eca-miR-885-5p
  5. Homo sapiens (human) hsa-miR-885-5p
  6. Macaca mulatta (Rhesus monkey) mml-miR-885-5p
  7. Oryctolagus cuniculus ocu-miR-885-5p
  8. Pongo pygmaeus (Bornean orangutan) ppy-miR-885-5p
  9. Pteropus alecto pal-miR-885-5p
  10. Sus scrofa (pig) ssc-miR-885-5p
Publications