v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pteropus vampyrus (large flying fox) microRNA 26a-1 (ENSPVAG00000027083.1) URS000023C301_132908

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAUGGGCCUAUUCUUGGUUACUUGCACGGGGACGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000013494.1)
  2. Castor canadensis miRNA (ENSCCNG00000022199.1)
  3. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000018771.1)
  4. Chlorocebus sabaeus microRNA 26a-1 (ENSCSAG00000025587.1)
  5. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000012651.1)
  6. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-26a (ENSGGOG00000029851.2)
  7. Gorilla gorilla microRNA ggo-mir-26a precursor
  8. Homo sapiens microRNA hsa-mir-26a precursor (hsa-mir-26a-1)
  9. Lagothrix lagotricha microRNA lla-mir-26a precursor
  10. Macaca fascicularis (Crab-eating macaque) microRNA 26a-1 (ENSMFAG00000004405.2)
  11. Macaca mulatta microRNA mml-mir-26a precursor (mml-mir-26a-1)
  12. Macaca nemestrina mne-mir-26a (ENSMNEG00000016928.1)
  13. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000009604.1)
  14. Marmota marmota marmota (Alpine marmot) microRNA 26a-1 (ENSMMMG00000011262.1)
  15. Microcebus murinus (gray mouse lemur) microRNA 26a-1 (ENSMICG00000019452.3)
  16. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 26a-1 (ENSNLEG00000022213.2)
  17. Pan paniscus microRNA ppa-mir-26a precursor
  18. Pan troglodytes (chimpanzee) microRNA ptr-mir-26a precursor (ptr-mir-26a-1)
  19. Papio anubis miRNA (ENSPANG00000016533.3)
  20. Piliocolobus tephrosceles miRNA (ENSPTEG00000022009.1)
  21. Pongo abelii miRNA (ENSPPYG00000022085.2)
  22. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-26a precursor
  23. Prolemur simus microRNA 26a-1 (ENSPSMG00000015322.1)
  24. Propithecus coquereli miRNA (ENSPCOG00000010341.1)
  25. Rhinopithecus bieti miRNA (ENSRBIG00000017113.1)
  26. Rhinopithecus roxellana microRNA 26a-1 (ENSRROG00000026838.1)
  27. Saimiri boliviensis boliviensis microRNA 26a-1 (ENSSBOG00000005383.1)
  28. Sciurus vulgaris (Eurasian red squirrel) microRNA 26a-1 (ENSSVLG00005025262.1)
  29. Spermophilus dauricus (Daurian ground squirrel) miRNA (ENSSDAG00000006330.1)
  30. Theropithecus gelada microRNA 26a-1 (ENSTGEG00000019619.1)
 Publications