Pan troglodytes (chimpanzee) ptr-miR-30e URS00001DE669_9598

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 9 other species
• 57 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGUAAACAUCCUUGACUGGAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

1. Danio rerio (zebrafish) dre-miR-30e-5p
2. Equus caballus eca-miR-30e
3. Homo sapiens (human) hsa-miR-30e-5p
4. Macaca fascicularis (crab-eating macaque) microRNA miR-30e-5p
5. Macaca mulatta (Rhesus monkey) mml-miR-30e-5p
6. Mus musculus mmu-miR-30e-5p
7. Pongo pygmaeus ppy-miR-30e
8. Rattus norvegicus rno-miR-30e-5p
9. Xenopus tropicalis (tropical clawed frog) xtr-miR-30e

Publications Download

• FASTA
• JSON