Equus caballus (horse) eca-miR-497 URS00001BC212_9796

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 13 other species
• 70 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

CAGCAGCACACUGUGGUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

1. Callithrix jacchus cja-miR-497
2. Canis lupus familiaris cfa-miR-497
3. Homo sapiens hsa-miR-497-5p
4. Macaca mulatta mml-miR-497-5p
5. Monodelphis domestica (gray short-tailed opossum) mdo-miR-497-5p
6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72460
7. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-497
8. Otolemur garnettii oga-miR-497
9. Pongo pygmaeus (Bornean orangutan) ppy-miR-497
10. Pteropus alecto (black flying fox) pal-miR-497-5p
11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62961
12. Sarcophilus harrisii sha-miR-497
13. Sus scrofa (pig) ssc-miR-497

Publications Download

• FASTA
• JSON