Bos taurus (cattle) bta-miR-15a URS00001BACF3_9913

• 21 nucleotides
• 3 databases (ENA, miRBase, RefSeq)
• Found in 11 other species
• 3362 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAGCAGCACAUAAUGGUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

1. Canis lupus familiaris cfa-miR-15a
2. Chiloscyllium plagiosum microRNA cpl-miR-15a
3. Gallus gallus gga-miR-15a
4. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72434
5. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-15a
6. Ornithorhynchus anatinus (platypus) oan-miR-15a-5p
7. Otolemur garnettii oga-miR-15a
8. Pteropus alecto (black flying fox) pal-miR-15a-5p
9. Sus scrofa (pig) ssc-miR-15a
10. Taeniopygia guttata tgu-miR-15a-5p
11. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1551775

Publications Download

• FASTA
• JSON