Capra hircus (goat) chi-miR-100-5p URS000017A252_9925

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 12 other species
• 123 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AACCCGUAGAUCCGAACUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

1. Cervus elaphus (red deer) cel-miR-100
2. Chrysemys picta cpi-miR-100-5p
3. Cricetulus griseus (Chinese hamster) cgr-miR-100-5p
4. Cyprinus carpio ccr-miR-100
5. Daubentonia madagascariensis (aye-aye) dma-miR-100
6. Monodelphis domestica (gray short-tailed opossum) mdo-miR-100-5p
7. Mus musculus Mus_musculus piRNA piR-mmu-8085145
8. Patiria miniata (sea bat) pmi-miR-100-5p
9. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-100
10. Sarcophilus harrisii sha-miR-100
11. Taeniopygia guttata (zebra finch) tgu-miR-100-5p
12. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1808276

Publications Download

• FASTA
• JSON