Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-221-3p URS0000170CF4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-221: Hsa-mir-221 is a microRNA implicated in various biological processes and diseases, including cancer [PMC6401030]. It is one of the microRNAs that target genes such as PTEN and DICER1, both of which are involved in oral carcinogenesis [PMC6034275]. In lung cancer, a survival prediction signature includes hsa-mir-221 as a protective factor [PMC4637011]. Elevated levels of hsa-mir-221 have been observed in endometrial carcinoma (EC) when compared to the normal endometrium (VP) [PMC4165582]. In ovarian cancer, statistical significance improved when analyzing hsa-mir-221 in combination with hsa-miR-1285 [PMC4278335]. Hsa-mir-221 is also highly associated with kidney renal clear cell carcinoma (KIRC) along with other miRNAs and long non-coding RNAs (lncRNAs) [PMC6251074]. Its abnormal expression is linked to the development of malignant tumors, including its counterpart hsa-miR-222 [PMC9917093]. Furthermore, hub target genes such as FOS and ESR1 have been identified for hsa-mir-221 through the analysis of miRNA-target gene relationships [PMC6171011].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUUGUCUGCUGGGUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 59 other species

  1. Alligator mississippiensis ami-miR-221-3p
  2. Anolis carolinensis (green anole) Aca-Mir-221-P2a_3p (mature (guide))
  3. Bos taurus (domestic cattle) Bta-Mir-221-P2a_3p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-221-P2a_3p (mature (guide))
  5. Callorhinchus milii (elephant shark) Cmi-Mir-221-P2a_3p* (star (passenger))
  6. Canis lupus familiaris (dog) Cfa-Mir-221-P2a_3p (mature (guide))
  7. Capra hircus miR-221
  8. Cavia porcellus cpo-miR-221-3p
  9. Cervus elaphus cel-miR-221
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-221-P2a_3p* (star (passenger))
  11. Columba livia Cli-Mir-221-P2a_3p (mature (guide))
  12. Cricetulus griseus (Chinese hamster) cgr-miR-221-3p
  13. Danio rerio (zebrafish) dre-miR-221-3p
  14. Dasypus novemcinctus dno-miR-221-3p
  15. Daubentonia madagascariensis dma-miR-221
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-221-P2a_3p (mature (guide))
  17. Equus caballus eca-miR-221
  18. Gadus morhua (Atlantic cod) Gmo-Mir-221-P2a1_3p (mature (guide))
  19. Gallus gallus (chicken) gga-miR-221-3p
  20. Gekko japonicus Gja-Mir-221-P2a_3p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-221 (MIR221)
  22. Gorilla gorilla ggo-miR-221
  23. Haplochromis burtoni abu-miR-221
  24. Latimeria chalumnae (coelacanth) Lch-Mir-221-P2a_3p (mature (guide))
  25. Lepisosteus oculatus (spotted gar) Loc-Mir-221-P2a_3p (mature (guide))
  26. Loxodonta africana (African savanna elephant) Laf-Mir-221-P2a_3p (mature (guide))
  27. Macaca mulatta (Rhesus monkey) mml-miR-221-3p
  28. Maylandia zebra mze-miR-221
  29. Microcebus murinus mmr-miR-221
  30. Monodelphis domestica (gray short-tailed opossum) mdo-miR-221-3p
  31. Monopterus albus (swamp eel) Mal-Mir-221-P2a1_3p (mature (guide))
  32. Mus musculus (house mouse) mmu-miR-221-3p
  33. Neolamprologus brichardi (lyretail cichlid) nbr-miR-221
  34. Nomascus leucogenys nle-miR-221
  35. Notamacropus eugenii (tammar wallaby) Neu-Mir-221-P2a_3p (mature (guide))
  36. Ophiophagus hannah oha-miR-221-3p
  37. Oreochromis niloticus oni-miR-221
  38. Ornithorhynchus anatinus (platypus) Oan-Mir-221-P2a_3p* (star (passenger))
  39. Oryctolagus cuniculus (rabbit) ocu-miR-221-3p
  40. Oryzias latipes ola-miR-221
  41. Otolemur garnettii (small-eared galago) oga-miR-221
  42. Ovis aries miscellaneous RNA
  43. Pan paniscus ppa-miR-221
  44. Pan troglodytes ptr-miR-221
  45. Papio hamadryas pha-miR-221
  46. Pongo abelii (Sumatran orangutan) Pab-Mir-221-P2a_3p (mature (co-guide))
  47. Pongo pygmaeus ppy-miR-221
  48. Pundamilia nyererei pny-miR-221
  49. Rattus norvegicus (Norway rat) rno-miR-221-3p
  50. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-221
  51. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-221-P2a_3p (mature (guide))
  52. Scyliorhinus torazame (cloudy catshark) Sto-Mir-221-P2a_3p* (star (passenger))
  53. Sphenodon punctatus (tuatara) Spt-Mir-221-P2a_3p (mature (guide))
  54. Taeniopygia guttata (zebra finch) tgu-miR-221-3p
  55. Takifugu rubripes (torafugu) fru-miR-221
  56. Tetraodon nigroviridis tni-miR-221
  57. Tor tambroides (Thai mahseer) miR-221-3p
  58. Xenopus laevis (African clawed frog) Xla-Mir-221-P2a4_3p (mature (guide))
  59. Xenopus tropicalis xtr-miR-221
Relationships

Molecular Relationships

GoFlow Results Publications