v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-221-3p URS0000170CF4_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-221: rno-mir-221 is a microRNA that has been quantified in various rat brain regions, including the prefrontal cortex (PFC), nucleus accumbens (NAc), and dorsal striatum, using quantitative PCR techniques [PMC4772274]. This microRNA is differentially expressed in rats with polycystic ovary syndrome (PCOS) compared to control rats, indicating a potential role in the pathophysiology of this condition [PMC4838149]. Additionally, rno-mir-221 is notably abundant in dihydrotestosterone (DHT)-treated ovaries, suggesting its involvement in ovarian responses to androgenic stimuli [PMC3682887]. It is also one of the microRNAs with experimentally validated targets according to ingenuity databases, which implies that rno-mir-221 may have multiple biological functions and could be involved in complex regulatory networks [PMC3682887]. Furthermore, rno-mir-221 has been associated with cardiac hypertrophy based on microRNA profiling studies, which could link it to cardiac pathologies [PMC5856749].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCUACAUUGUCUGCUGGGUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 59 other species

  1. Alligator mississippiensis ami-miR-221-3p
  2. Anolis carolinensis (green anole) Aca-Mir-221-P2a_3p (mature (guide))
  3. Bos taurus (domestic cattle) Bta-Mir-221-P2a_3p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-221-P2a_3p (mature (guide))
  5. Callorhinchus milii (elephant shark) Cmi-Mir-221-P2a_3p* (star (passenger))
  6. Canis lupus familiaris (dog) Cfa-Mir-221-P2a_3p (mature (guide))
  7. Capra hircus miR-221
  8. Cavia porcellus cpo-miR-221-3p
  9. Cervus elaphus cel-miR-221
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-221-P2a_3p* (star (passenger))
  11. Columba livia Cli-Mir-221-P2a_3p (mature (guide))
  12. Cricetulus griseus (Chinese hamster) cgr-miR-221-3p
  13. Danio rerio (zebrafish) dre-miR-221-3p
  14. Dasypus novemcinctus dno-miR-221-3p
  15. Daubentonia madagascariensis dma-miR-221
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-221-P2a_3p (mature (guide))
  17. Equus caballus eca-miR-221
  18. Gadus morhua (Atlantic cod) Gmo-Mir-221-P2a1_3p (mature (guide))
  19. Gallus gallus (chicken) gga-miR-221-3p
  20. Gekko japonicus Gja-Mir-221-P2a_3p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-221 (MIR221)
  22. Gorilla gorilla ggo-miR-221
  23. Haplochromis burtoni abu-miR-221
  24. Homo sapiens hsa-miR-221-3p
  25. Latimeria chalumnae (coelacanth) Lch-Mir-221-P2a_3p (mature (guide))
  26. Lepisosteus oculatus (spotted gar) Loc-Mir-221-P2a_3p (mature (guide))
  27. Loxodonta africana (African savanna elephant) Laf-Mir-221-P2a_3p (mature (guide))
  28. Macaca mulatta (Rhesus monkey) mml-miR-221-3p
  29. Maylandia zebra mze-miR-221
  30. Microcebus murinus mmr-miR-221
  31. Monodelphis domestica (gray short-tailed opossum) mdo-miR-221-3p
  32. Monopterus albus (swamp eel) Mal-Mir-221-P2a1_3p (mature (guide))
  33. Mus musculus (house mouse) mmu-miR-221-3p
  34. Neolamprologus brichardi (lyretail cichlid) nbr-miR-221
  35. Nomascus leucogenys nle-miR-221
  36. Notamacropus eugenii (tammar wallaby) Neu-Mir-221-P2a_3p (mature (guide))
  37. Ophiophagus hannah oha-miR-221-3p
  38. Oreochromis niloticus oni-miR-221
  39. Ornithorhynchus anatinus (platypus) Oan-Mir-221-P2a_3p* (star (passenger))
  40. Oryctolagus cuniculus (rabbit) ocu-miR-221-3p
  41. Oryzias latipes ola-miR-221
  42. Otolemur garnettii (small-eared galago) oga-miR-221
  43. Ovis aries miscellaneous RNA
  44. Pan paniscus ppa-miR-221
  45. Pan troglodytes ptr-miR-221
  46. Papio hamadryas pha-miR-221
  47. Pongo abelii (Sumatran orangutan) Pab-Mir-221-P2a_3p (mature (co-guide))
  48. Pongo pygmaeus ppy-miR-221
  49. Pundamilia nyererei pny-miR-221
  50. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-221
  51. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-221-P2a_3p (mature (guide))
  52. Scyliorhinus torazame (cloudy catshark) Sto-Mir-221-P2a_3p* (star (passenger))
  53. Sphenodon punctatus (tuatara) Spt-Mir-221-P2a_3p (mature (guide))
  54. Taeniopygia guttata (zebra finch) tgu-miR-221-3p
  55. Takifugu rubripes (torafugu) fru-miR-221
  56. Tetraodon nigroviridis tni-miR-221
  57. Tor tambroides (Thai mahseer) miR-221-3p
  58. Xenopus laevis (African clawed frog) Xla-Mir-221-P2a4_3p (mature (guide))
  59. Xenopus tropicalis xtr-miR-221
 Relationships

Molecular Relationships

 Publications