v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-424-5p URS00000F0F49_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGCAGCAAUUCAUGUUUUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus Bta-Mir-15-P1c_5p (mature (guide))
  2. Canis lupus familiaris (dog) Cfa-Mir-15-P1c_5p (mature (guide))
  3. Cavia porcellus cpo-miR-424-5p
  4. Dasypus novemcinctus dno-miR-424-5p
  5. Eptesicus fuscus efu-miR-424
  6. Equus caballus (horse) eca-miR-424
  7. Homo sapiens (human) hsa-miR-424-5p
  8. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-49665523
  9. Nomascus leucogenys nle-miR-424
  10. Oryctolagus cuniculus (rabbit) ocu-miR-424-5p
  11. Pan paniscus ppa-miR-424
  12. Pan troglodytes (chimpanzee) ptr-miR-424
  13. Pongo pygmaeus ppy-miR-424
  14. Saimiri boliviensis boliviensis sbo-miR-424
  15. Sus scrofa (pig) ssc-miR-424-5p
 Publications